Characterization of Recombinant Extracellular Domain of Human Interleukin-10 Receptor (1) ,
IL-10 possesses immunostimulatory activity for the growth and differentiation of activated B cells, cytokine-activated T cells, and mast cells.
To develop antiserum to IL-10, P55 22-mer peptide (RPKMAPANDTYESIFSHFREYE), corresponding to amino acids 147 to 168 of the hIL-10 receptor were used.
The soluble recombinant IL-10 receptors were developed by the following.
Oligonucleotides used as polymerase chain reaction primers were synthesized according to the reported sequence of human IL-10 receptor cDNA (Ref. 2, GenBankTM data base, Accession No. U00672) using the ABI 394 DNA Synthesizer.
Primer C3628CC, 5′GCAGCGAATTCGTCGACGCCGCCACCATGCTGCCGTGCCTCGTAGTGCT3′, corresponding to the 5′ end of the sense strand (nucleotides 62 to 84), contains an EcoRI and a SalI site 5′ of the translation initiation codon (italicized).
Primer C3629CC, 5′CACTCT-CCCTCACCGGTACCCATTGCTGTGGTACAGGTCCAAGGTC3′, corresponding to the reverse strand (nucleotides 320 to 352 of the sense strand), contains a conservative base change as underlined to create a KpnI site.
Primer C3630CC, 5′GTACCACAGCAATGGGTACCGGGCCAGAGTGCGGGCTGTGGAC3′, corresponding to the sense strand (nucleotides 331 to 373), is approximately 300 bases 3′ of the initiation codon and contains a conservative base change as underlined to create a KpnI site.
Primer C3631CC, 5′GCTTCAGTAGCTGGATCCGAATTCTCAGTTGGTCACCGTGAAATACTGCCTGGTGAGGGAGATGC3′, corresponding to the reverse strand (nucleotides 668 to 767 of the sense strand) and the juxtamembrane region, contains a complementary stop codon (italicized), a conservative base change to create a BstEII site (underlined), and EcoRI and a BamHI sites 5′ of the complementary stop codon.
Using pSW8.1, a human IL-10 receptor cDNA clone as the template, polymerase chain reactions were carried out with primers C3628CC and C3629CC to produce an approximately 300-base pair fragment which corresponds to the amino-terminal peptide, and with primers C3630CC and C3631CC to produce an approximately 440-base pair fragment which corresponds to the membrane proximal half of the extracellular region.
A purified soluble hIL-10 receptor was detected as a group of three species migrating with apparent molecular masses between 35,000 and 45,000, as analyzed by SDS-PAGE. Both the glycosylated and deglycosylated forms were detectable by the anti-P55 antiserum. The deglycosylated form is recognized more strongly by the antiserum, probably reflecting the increased accessibility of the antiserum to soluble hIL-10 receptors in the absence of the carbohydrate side chains.
Ba8.1 cell proliferation assays were performed based on the following procedures. 15,000 cells per well were seeded in 100 μl final volume assay media (RPMI 1640 with 10% fetal calf serum, 2 mM glutamine, and 50 μM 2-mercaptoethanol) in 96-well tissue culture plates for 48 h with CHO-derived human IL-10 at 100 pM, previously determined to be the concentration of hIL-10 for half-maximal stimulation of Ba8.1 cells, and with 2-fold serial dilutions of purified soluble hIL-10 receptor starting at 400 nM. Proliferation was measured by MTS reduction using the CellTiter 96 aqueous assay system. The purified soluble hIL-10 receptor protein can inhibit the ability of hIL-10 to induce the proliferation of Ba8.1 cells in a dose-dependent manner.
For cytokine synthesis inhibition assays, the assay medium consisted of RPMI 1640, 50 units/ml penicillin, 50 μg/ml streptomycin, 110 μg/ml sodium pyruvate, 0.1 mM non-essential amino acids, 5% fetal bovine serum, 80 ng/ml lipopolysaccharide, and 10 pM hIL-10. The amount of hIL-10 was previously determined to be required for half-maximal inhibition of hIL-1β synthesis. The assay medium was added to 96-well tissue culture plates along with 10-fold serial dilutions of soluble hIL-10 receptor with a highest final concentration at 1 μM. 2 × 10^5 PBMC were then added per well in a final total volume of 200 μl. After a 6-h incubation at 37°C, the level of hIL-1β was measured using the Quantikine System on the conditioned media diluted to 1:100.The purified soluble hIL-10 receptor is able to overcome the IL-1β synthesis inhibitory activity of hIL-10 on activated mononuclear cells in a dose-responsive manner.
The extracellular region of human IL-10 receptor cDNA can be expressed in soluble form and purified by ligand affinity. The purified protein is able to bind hIL-10 and prevent hIL-10 from binding to the full-length cellular receptor. The soluble hIL-10 receptor is also able to inhibit the in vitro biological activity of hIL-10 such as growth stimulation of Ba8.1 and cytokine synthesis inhibition in activated monocytes. At a receptor/ligand molar ratio of 1:1, a complex of one hIL-10 dimer-one soluble receptor was formed.